Original Article
Evaluation of a prepared combined inactivated vaccine
against hemorrhagic disease virus 2 and Clostridium perfringens type A
infections in rabbit
Evaluación de una vacuna
preparada combinada inactivada contra la infección en conejos del virus de la
enfermedad hemorrágica tipo 2 y el Clostridium
perfringens tipo A
Mahmoud M.
Abotaleb1*ORCID: https://orcid.org/0000-0001-9303-539X
Rasha G.
Tawfik2 ORCID: https://orcid.org/0000-0002-6286-3958
Dalia
M. Omar1 ORCID:
https://orcid.org/0000-0002-7282-4346
Farida H. Mohamed3 ORCID: https://orcid.org/0000-0002-6357-5085
Shereen M. Aly3 ORCID: https://orcid.org/0009-0004-4425-5504
Noura M.
Khalaf4 ORCID: https://orcid.org/0009-0005-9024-2859
Samir
A. Nassif1 ORCID: https://orcid.org/0000-0002-7907-0102
1 Central
Laboratory for Evaluation of Veterinary Biologics (CLEVB), Agricultural
Research Center (ARC). Cairo, Egypt.
2 Department
of Microbiology, Faculty of Veterinary Medicine, Alexandria University. Egypt.
3 Department
of immunology, Animal Health Research Institute (AHRI), Agriculture Research
Center (ARC). Dokki, Egypt.
4 Department
of Anaerobic bacteria, Veterinary Serum and Vaccine Research Institute (VSVRI),
Agriculture Research Center (ARC). Cairo, Egypt.
Corresponding author: M.abotaleb84@yahoo.com
ABSTRACT
Rabbit
hemorrhagic disease virus 2 and Clostridium perfringens type A cause
infections in rabbit. Vaccines are considered an effective strategy for
fighting these infections. Nowadays, the demand for using a nanoparticle adjuvant as (Montanide™ IMS) is increased due
to its ability for enhancing both humoral and cell mediated immunity and,
in addition, it can be administrated through different routes. An inactivated vaccine against rabbit hemorrhagic disease
virus 2 and Clostridium perfringens type A which adjuvanted by Montanide™ IMS 1313 N VG PR (IMS 1313) was developed. The
prepared vaccine was evaluated in rabbits for sterility, safety and potency via
two different routes of vaccination. Oral administration of inactivated vaccine
was evaluated as an alternative route to subcutaneous vaccination. The results
revealed that rabbits vaccinated by subcutaneous route exhibited satisfactory
antibody and antitoxin titer against rabbit hemorrhagic disease virus 2 and Clostridium
perfringens type A, respectively, from 2nd week post vaccination
and reached the peak at 3th week post vaccination. On the other
hand, antibody and antitoxin titer of orally vaccinated rabbits didn't reach the satisfactory level. Rabbits vaccinated
orally were not protected against virulent rabbit hemorrhagic disease virus 2,
with 30% protection, while rabbits vaccinated subcutaneously showed
satisfactory protection (90%). Serum nitric oxide and lysozyme activity had
significant differences between vaccinated and control rabbits. The level of
nitric oxide and lysozyme in sera of subcutaneously vaccinated rabbits was
higher than that of orally vaccinated rabbits. Interleukin-6 and tumor
necrosis factor-ɑ were determined in the spleen of vaccinated rabbits,
significant differences were obtained between subcutaneously and orally
vaccinated rabbits. It was concluded that the
combined vaccine is potent when inoculated by subcutaneous route in contrast to
the oral route. The Montanide™ IMS 1313 adjuvant is a product that can be used for rabbit vaccine
preparation.
Keywords: combined vaccines; humoral immune response; IL-6; rabbits; rabbit
hemorrhagic disease virus.
RESUMEN
El virus de la enfermedad hemorrágica del conejo
tipo 2 y el Clostridium perfringens
tipo A causan infecciones en conejos. Las vacunas se consideran una estrategia
eficaz para combatir estas infecciones. Hoy en día, la demanda para el uso de
un adyuvante de nanopartículas como Montanide™ IMS es
cada vez mayor debido a su capacidad para mejorar la inmunidad humoral y la
mediada por células, y a la posibilidad de administrarla por diferentes vías.
En este estudio se desarrolló una vacuna inactivada contra el virus de la
enfermedad hemorrágica del conejo tipo 2 y el Clostridium
perfringens tipo A, adyuvada
con Montanide™ IMS 1313 N VG PR (IMS 1313). Se evaluó
la vacuna preparada en cuanto a esterilidad, seguridad y potencia en conejos
mediante dos vías diferentes de vacunación. Se evaluó la administración oral de
la vacuna inactivada como vía alternativa a la vacunación subcutánea. Los
resultados revelaron que los conejos vacunados por vía subcutánea presentaban
títulos satisfactorios de anticuerpos y antitoxinas contra el virus 2 de la
enfermedad hemorrágica del conejo y el Clostridium
perfringens tipo A, respectivamente, a partir de
la segunda semana de vacunación y alcanzaron el máximo en la tercera semana. En
cambio, los títulos de anticuerpos y antitoxinas de los conejos vacunados por
vía oral no alcanzaron un nivel satisfactorio. Los conejos vacunados por vía
oral no mostraron protección contra el virus virulento de la enfermedad
hemorrágica del conejo tipo 2, con un 30% de protección, mientras que los
conejos vacunados por vía subcutánea mostraron una protección satisfactoria
(90%). El óxido nítrico sérico y la actividad de la lisozima presentaron
diferencias significativas entre los conejos vacunados y los controles. El
nivel de óxido nítrico y lisozima en el suero de los conejos vacunados por vía
subcutánea fue superior al de los conejos vacunados por vía oral. Se determinaron
la interleucina-6 y el factor de necrosis tumoral-ɑ en el bazo de los
conejos vacunados, y se obtuvieron diferencias significativas entre los conejos
vacunados por la vía subcutánea y la oral. Se concluyó que la vacuna combinada
es potente cuando se inocula por vía subcutánea en contraste con la vía oral.
El adyuvante Montanide™ IMS 1313 es un producto que
puede utilizarse para la preparación de vacunas para conejos.
Palabras clave: vacunas combinadas; inmunidad humoral; IL-6;
conejos; virus de la enfermedad hemorrágica del conejo.
Recibido: 14 de diciembre de 2023
Aceptado: 2 de mayo de 2024
Introduction
Rabbit industry
is very important because its meat is considered a delicacy because of its high
palatability and nutritive value. However, it currently faces several
constraints threatening its growth and continual development. The emergence of
bacterial and viral pathogens causes huge losses. Rabbit hemorrhagic disease virus (RHDV) and Clostridium
perfringens type A have gained particular concern in this field.
Rabbit
hemorrhagic disease (RHD) is a highly fatal viral disease that causes heavy
losses among rabbits. The newly emerging RHDV2 was detected in vaccinated
flocks in mid-2018.(1) RHDV2
infected rabbits developed sudden death and blood stains on the nose caused by
internal bleeding with high morbidity and an average mortality ranged from
5–70%. After that, the pathogenicity of RHDV2 increased with an adult mortality
rate ranging from 70 to 100%.(2) Rabbits infected by ancient isolated
RHDVs, either classical or variants, show high morbidity and mortality rates in
adult rabbits, but young rabbits less than 6-8 weeks old are less susceptible;
RHDV2 is able to infect young rabbits (15-25 days of age).(3) Enterotoxemia or bloat is a severe diarrheal disease that
primarily affects 4 to 8 week old rabbits that are naturally infected and it
can also affect rabbits of any age with mortality rates of up to 50%; it is
characterized by lethargy, rough coat, greenish brown fecal material covering
the perineal area, and death within 48 hours and the primary causative agent is
C. perfringens type A.(4)
Vaccination
of rabbits is widely used to control bacterial and viral infections. Using
autogenously inactivated culture against RHDV and toxoid vaccine against
clostridial infection has been extensively used
over the past decades. Using combined vaccines
has the advantage of protecting against more than one disease at the same time,
enhancing the immune response of the vaccinated rabbits, reducing vaccination
expenses and decreasing the stress of vaccinating with different vaccines.(5) Inactivated
vaccines adjuvanted by aluminum hydroxide gel or Montanide ISA 70 VG can provide satisfactory protection
against these infections.(6,7) The use of Montanide™ ISA series
as adjuvant has increased after being tested in different vaccine formulations
for different animal species and proving to be safe and efficacious. For example, IMS 1313 N VG PR is an
aqueous-based nanoparticles adjuvant that has generated superior
immunostimulant activity against veterinary vaccines.
It is also eligible for mass oral delivery and parental vaccination,
which can enhance immune protection in different animal species.(8)
Lysozyme and nitric oxide (NO) are important innate immune parameters. Lysozyme
plays several roles in host defense mechanisms including antibacterial,
antiviral, and immunomodulatory effects.(9) In addition, NO, a free
radical that acts as a pro-inflammatory cytotoxic mediator and is produced by
inducible nitric oxide synthases (iNOS) in activated
macrophages and neutrophils, regulates a number of immunological and physiological
processes.(10) It is generally known that in poultry and mammals,
the activation of the innate immune system is characterized by the production
of inflammatory cytokines like interleukin-6 (IL-6) and tumor necrosis factor-ɑ
(TNF) that are an integral part of the immune response to vaccination.(11)
Therefore, the present study was designed to prepare and asses the efficacy of
a combined inactivated vaccine against RHDV2 and C.
perfringens type A infections, adjuvanted with Montanide™
ISA 1313, using different administration routes (subcutaneously and oral) in
susceptible rabbits.
Materials and
Methods
Ethical approval
Animal subject
All
methods were performed according to relevant guidelines and regulations. All
experiments were carried out according to ARRIVE 2.0 guidelines and were
approved by the Institutional Animal Care and Use Committee (IACUC) in the
Faculty of Veterinary Medicine, Cairo University (Code: VetCU01102020217).
Human subject
This
study was conducted in accordance with the ethical standards outlined in the
Declaration of Helsinki and was approved by the Institutional Ethics Committee
at Central Laboratory for Evaluation of Veterinary Biologics (CLEVB).
Experimental animals
Rabbits
One hundred and
fifty-four, seronegative New Zealand White rabbits,
males, as 45 days old were purchased from a conventional rabbit try in Qalubia governorate. Rabbits were required for vaccine
evaluation.
Mice
Two
hundred Swiss white mice (18-20 gm) were obtained from CLEVB.
They were used to evaluate the potency of C. perfringens type A in the
prepared vaccines.
Strains
RHDV2
Local
RHDV2 isolate was supplied by the CLEVB Reference Strain Bank Department. It
was submitted to the gene bank as (HDV\Vet-Abotaleb),
under accession number MN276176, with a titer of 105.1 Lethal Dose
(LD)50/mL and Hemagglutination (HA) titer equal to 214
Hemagglutination units (HAU).
Clostridium perfringens type A strain
A
locally isolated vaccinal C. perfringens type A strain was obtained from
Anaerobic Vaccines Research Department, (Veterinary Serum and Vaccine Research
Institute (VSVRI)), Abbasia, Cairo, Egypt.
Standard C.
perfringens type A antitoxin
C. perfringens type A
antitoxin was obtained from National Institute for a Biological Standard
Control, United Kingdom. It contains 270 IU/mL alpha antitoxin.
Toxin
Dried
alpha toxin of C. perfringens type A was prepared according to.(7)
Inactivation of virus and
bacteria
RHDV2
suspension was inactivated using formalin with a final concentration of 2% of
the total volume for 48 h.(6)
Culture
suspension from highly toxigenic isolates of C. perfringens type A was
inactivated by formalin in 0.5% concentration.(7)
Assessment
of virus and bacteria inactivation was achieved through injection of each
inactivated suspension into five rabbits and keeping two rabbits as controls.
If the inoculated rabbits did not subsequently show clinical signs of diseases
like RHDV2 (sudden death and blood stains on the nose) and enterotoxemia
(lethargy, rough coat, greenish brown fecal material covering the perineal
area) or mortality, each inactivated suspension was considered ready to be
emulsified with the vaccine adjuvant.(7)
Adjuvant
It
was used Montanide™ IMS 1313 N VG PR (IMS 1313;
SEPPIC, France) to formulate a combined vaccine; it was mixed with an equal
volume of inactivated suspension of RHDV2 and C. perfringens type A
strain cultures with a ratio of 50:50 as recommended by the manufacturer.
Vaccine preparation(7)
Two
equal inactivated suspensions (to occupy 50% of preparation volume) were
adjuvanted by Montanide™ IMS 1313 N VG PR (to occupy
50% of remaining preparation volume). The recommended vaccine dose was adjusted
to contain 210 HAU from inactivated suspension of RHDV2 and
60 Minimum Lethal Dose (MLD) of C. perfringens alpha toxoid per vaccine
dose. The vaccine was administrated orally and subcutaneously (S/C) with a dose
(0.5 mL/animal).
Erythrocyte
suspension
Erythrocytes
human type "O" were collected from a healthy volunteer (with prior
informed consent of the volunteer). A 3.8% sodium citrate solution was use as
anticoagulant. The packed erythrocytes were suspended in sterile saline in a
concentration of 0.75% for micro-technique of HA and Hemagglutination
inhibition (HI) tests.(3)
Evaluation of
combined prepared vaccine
Sterility test
It was done to
determine if the vaccine samples were free of bacterial, fungal and mycoplasma
contaminants and acceptable for release. All vaccine vials were tested
individually. One mL of each vaccine sample was inoculated into bacterial and
fungal media plates. The inoculated media were incubated aerobically and
anaerobically for 21 days at different degrees of temperature. Inoculated media
were inspected for possible growth.(3,4)
Safety test
Ten
seronegative rabbits were inoculated with double dose of prepared candidate
inactivated vaccine subcutaneously and orally (five rabbits each route). Two
control rabbits were kept along the test. Vaccinated rabbits were observed for
any possible local or systemic adverse reaction due to vaccine for 21 days.
Potency test
Evaluation of the immune response to C. perfringens type A
It was done
using Toxin neutralization test.(7)
The mean C. perfringens type A alpha antitoxin titers in sera from
vaccinated rabbits were measured using Toxin neutralization test (IU/mL) which
was applied in mice.
Evaluation of the immune response to RHDV2
The HA test was
done to determine the HAU for RHDV2 antigen.(3)
The HI test(3) was done to estimate specific
RHDV antibodies in rabbit sera. The test was carried out using 8 HAU of RHDV
and human RBCs type "O".
Ten
rabbits from each group were challenged (3) intramuscularly at a
dose of 1 mL/rabbit with 100 LD50 of
local RHDV2 after 3rd weeks post vaccination (WPV). Observations for
clinical signs and death were carried out for 14 days post challenge.
Protection
(%) = Number of survivals/Total number of challenged rabbits X 100.
Lysozyme Assay
It was done by agarose gel plate lysis assay.(12)
Measuring of serum nitric
oxide (NO)(13)
Serum proteins
were precipitated by centrifuging 100 µL of the serum sample at 13,000 rpm for
20 min after mixing it with 80 µL of ZnSO4 and 120 µL of NaOH.
Supernatant was obtained and added to 400 mg of copper-plated cadmium, adding
100 µL of 0.2 M glycine buffer and shook for 2.5 h. Griess reagent (100 µL) was
added to 100 µL of supernatant in a 96-well ELISA plate. The optical density
was determined at 545 nm with an ELISA plate reader. NO concentration was
calculated from the standard curve of NaNO2 solution.
Determination of IL-6 and
TNF-α mRNA in spleen tissue by quantitative real time-PCR (qRT-PCR)
RNA extraction and
purification from spleen samples were performed using QIAamp
RNeasy Mini kit (Qiagen, Germany, GmbH). The used oligonucleotide primers of
IL-6 and TNF-α were illustrated in Table 1 (Metabion,
Germany). The SYBR green qRT-PCR reaction was
performed in a Stratagene MX3005P real time PCR
machine and the analysis of qRT-PCR results were
determined by using the amplification curves and threshold cycles (CT) values (stratagene MX3005P software). To estimate the differences
of fold changes in the mRNA gene expression of the different samples, the CT of
each sample was compared with that of the positive control group according to
the "-2ΔΔCt” method.(14)
Table 1. Primer sequences for
quantitative real time-PCR.
|
Target gene |
Primers sequences |
References |
|
GAPDH* |
TGACGACATCAAGAAGGTGGTG |
Schnupf P, et
al.(15) |
|
|
GAAGGTGGAGGAGTGGGTGTC |
|
|
IL-6 |
CTACCGCTTTCCCCACTTCAG |
|
|
|
TCCTCAGCTCCTTGATGGTCTC |
|
|
TNF-α |
GTCTTCCTCTCTCACGCACC |
Godornes C, et
al.(16) |
|
|
TGGGCTAGAGGCTTGTCACT |
|
*GAPDH:
glyceraldehyde 3-phosphate dehydrogenase, served as an internal control for
sample normalization.
Experimental design
One hundred and
fifty-four, seronegative rabbits divided into three groups (group 1, group 2
and group 3) were used in this study. Groups 1 and 2 were composed of 12
rabbits (each) used for assessing complete inactivation of virus and bacteria
and testing vaccine safety, respectively. Group 3 was composed of 130 rabbits
used for evaluation of the prepared vaccine which was divided into 3 subgroups
as follows:
Subgroup 1 (50
rabbits): vaccinated with combined vaccine S/C.
Subgroup 2 (50
rabbits): vaccinated with combined vaccine oral one drop.
Subgroup 3 (30
rabbits): kept as non-vaccinated challenged group (control +ve).
Ten and five rabbits
from each of the vaccinated and control groups, respectively, were bled weekly
till 4thWPV. Sera collected from vaccinated and control rabbits were
tested for detection of RHDV2 HI antibodies using HI
test; the Toxin neutralization test was applied in mice for determination
of antitoxin titer for C. perfringens type A. Calculation of lysozyme activity and NO were achieved through
examination of collected antisera at 1st, 2nd, 3rd
and 4th WPV. Spleen tissues of vaccinated rabbits were examined at 1st
and 2nd WPV using quantitative real time-PCR (qRT-PCR)
for determination of IL-6 and TNF-α mRNA. Challenge test
against RHDV2 infection was performed at 3th WPV in ten and five
rabbits from each vaccinated group and control, respectively.
Statistical analysis
Data generated from immune
responses were subjected to one-way analysis of variance (ANOVA).
Results
Assessment on virus and
bacteria inactivation
All rabbits
injected with formalin-treated virus and bacteria were kept alive without any clinical
signs.
Sterility and safety
The tested vaccine was free
from bacterial and fungal contamination. Furthermore,
the prepared vaccine was found safe and no clinical symptoms appeared in
seronegative rabbits, after S/C and oral inoculation with double recommended
dose.
Potency
Evaluation of the immune
response to C. perfringens type A
The
mean C. perfringens type A alpha antitoxin titers in sera from
vaccinated rabbits (IU/mL) are shown in Figure 1. Mean C. perfringens type
A alpha antitoxin titer in sera from rabbits vaccinated orally was 0.5
IU/mL at 1st WPV and reached to 2 IU/mL at 3rd WPV. While
the antitoxin titer of vaccinated rabbits by S/C was 2 IU/mL at 1st
WPV and gradually increased until reach 6 IU/mL at 4th WPV.
Fig. 1. Mean C. perfringens type A alpha antitoxin titers in sera
from vaccinated rabbits using Toxin neutralization test (IU/mL) in mice. WPV:
weeks post vaccination. S/C route: subcutaneous route.
Evaluation of the immune
response to RHDV2
Hemagglutination
inhibition test for RHDV2
As shown in Figure 2, mean RHDV2-HI antibody titers
were 2, 3, 3.5 and 3.5 in sera from orally vaccinated rabbits at 1st,
2nd, 3rd and 4th WPV, respectively; while
rabbits that were vaccinated by S/C route had higher immune response, with 5,
7.3, 8 and 8 HI titers at 1st, 2nd, 3rd and 4th
WPV, respectively.
Fig. 2. Mean RHDV2-HI
antibody titers in sera of vaccinated rabbits at 1st, 2nd,
3rd and 4th weeks post vaccination (WPV). S/C route: subcutaneous route.
Protection percent against RHDV2 challenge
The percentage
of protection for the orally vaccinated rabbits challenged at 3rd
WPV recorded 30%, while the S/C inoculated group had a higher protection
percentage, reaching 90% at 3rd WPV (Figure 3). All control rabbits
died with RHDV2-specific lesions after 48 h.
Fig.
3. Protection (%) against RHDV challenge at 3rd week post
vaccination (WPV). S/C route: subcutaneous route.
Lysozyme
activity
The
results of serum lysozyme assay in rabbits (Table 2) showed marked increase in
both oral and S/C route compared to the control group. Administration by the S/C
route induced the highest level of lysozyme at all time intervals, the increase
was significant compared to the control at all time intervals; it also induced
a significant increase compared to oral route at 2nd and 3rd
WPV. While the oral route induced a significant increase compared to control
group only at 1st, 2nd and 3rd WPV.
Table 2. Serum
lysozyme test results.
|
|
|
Serum
lysozyme level (µg/mL) |
|
|
Week post vaccination (WPV) |
Control |
Oral route |
S/C route |
|
1st WPV |
80.25 ± 4.95a |
122.35±13.99b |
139.28±8.75b |
|
2nd WPV |
83.75±5.45a |
131.28±8.75b |
152.03±2.47c |
|
3rd WPV |
81.25±5.90a |
144.30±3.70b |
196.35±24.65c |
|
4th WPV |
79.60±7.80a |
90.05±5.05ab |
109.95±4.95b |
Data are presented as the
mean ± SE. Means with different superscript small letter indicate significantly
different at the same row between groups at P < 0.05 using one-way
ANOVA test.
Serum nitric
oxide levels
Regarding
the results of NO assay (Table 3), both vaccination routes induced higher NO
values than the control group. The S/C route induced the highest significant
increases in values for all groups at all time intervals. However, the oral
route induced significant increased values compared to the control group only
at 1st and 2nd WPV.
Table 3. Serum
nitric oxide assay results.
|
|
|
Serum nitric oxide level (µmol/mL) |
|
|
Week post vaccination
(WPV) |
Control |
Oral route |
S/C route |
|
1st
WPV |
11.6 ± 0.27a |
16.1±1.28b |
25.59±1.15c |
|
2nd
WPV |
10.71±0.36a |
17.37±2.15b |
25.90±3.91c |
|
3rd
WPV |
11.23±2.17a |
13.75±2.79a |
21.1±1.15b |
|
4th
WPV |
10.90±0.12a |
13.20±1.03a |
15.27±1.14b |
Data are presented as the
mean ± SE. Means with different superscript small letter indicate significantly
different at the same row between groups at P < 0.05 using one-way
ANOVA test.
Cytokine mRNA gene
expression of IL-6 and TNF-ɑ in rabbit spleen
The results of
mRNA of IL-6 and TNF-α in rabbits’ spleen are illustrated in Table 4. The
S/C route induced the highest values at all time intervals. There were
significant increased values of IL-6 at 2nd WPV and significant
higher values of TNF-ɑ in S/C group at 1st
and 2nd WPV compared to the oral route group.
Table 4. Results of cytokine mRNA gene expression of
IL-6 and TNF- ɑ.
|
|
|
Cytokines mRNA gene (fold change) |
|
|
Cytokines |
WPV |
Oral route |
S/C route |
|
IL-6 |
1st
WPV |
6.68±0.35 |
7.01±0.53 |
|
|
2nd
WPV |
8.28±0.69a |
13.55±0.43b |
|
TNF-ɑ |
3rd
WPV |
4.66±0.51a |
6.68±0.5b |
|
|
4th
WPV |
6.49±0.35a |
11.79±0.17b |
Quantitative real-time-PCR
for mRNA expression of IL-6 and TNF-ɑ genes in rabbits. 2−ΔΔCt
method was used to calculate the relative expression fold change. Data are
presented as the mean ± SE. Means with different superscript small letter
indicate significantly different at the same row between groups at P <
0.05 using one-way ANOVA test.
Discussion
Vaccination has become an
effective and commonly used strategy to prevent spread of disease among rabbits.(6,7) The use
of bivalent vaccines provides better protection compared to monovalent
vaccines, besides making vaccination more economical and cost-effective.(5)
RHDV2 and C. perfringens type A are among the main responsible for
morbidity and mortalily, especially among young
rabbits.(1,4) This study aimed to develop and evaluate a combined
inactivated vaccine against RHDV2 and enterotoxemia
adjuvanted with Montanide™ IMS 1313 using different
routes of vaccine administration (subcutaneous and oral). Using nanoparticle
adjuvants as (Montanide™ IMS) is increased nowadays
due to contain an immunostimulating compound and
their potential ability to enhance both humoral and cell-mediated immunity.(17)
The using of Montanide as an adjuvant in this study
enhances the advantages of the vaccine and can facilitate antigen uptake by
Antigen Presenting Cells, which presumably improves antigen processing and
presentation via major histocompatibility complex (MHC) class II and class I.
The use of this type of adjuvant to protect young rabbits from infection, due
to its ability to exhibit early and satisfactory immune response is consistent
with a study(8) that
demonstrated the ability of Montanide™ Seppic IMS1313 to enhance immune protection in different
animal species. Furthermore, oral administration of the prepared vaccine in the
present study is supported by a study of other authors,(18)
who said that the Montanide™ Seppic
IMS1313 adjuvanted vaccine may also be eligible for oral mass vaccination.
Evaluation of the prepared combined vaccine was done according
international protocols as OIE, which include assessing sterility, safety and
potency. The prepared vaccine was free of any contamination without any adverse
effect on vaccinated rabbits. Concerning vaccine potency, individual blood
samples were collected weekly from all rabbit groups and examined against RHDV2
and C. perfringens type A alpha
antitoxin titers using HI and Toxin neutralization tests, respectively. Antibody titers against RHDV2
antigen exhibited in orally vaccinated rabbits were very low and did not reach
a satisfactory antibody level according to OIE,(3)
which requires ≥6 log HI antibodies in serum samples collected 3-4
weeks after vaccination for approval. Also, the mean C.
perfringens type A alpha antitoxin titers in sera from the same
vaccinated rabbits measured by Toxin neutralization test did not reach the
protective titer until the 4th WPV according to United States
Department of Agriculture (USDA),(19) which determines that the
satisfactory titer is not lower than the permissible limit (4 IU/mL) to be
valid. Previous data revealed the oral administration of the vaccine can
stimulate the immune system, but without an efficient role in producing a satisfactory
level of antibodies against RHDV2 or C.
perfringens type A, these results
were consistent with others(8) that proved the oral route of
delivery had practical limitations, including low pH, gastric proteolytic
enzymes, rapid transit through the intestine and poor absorption of large
molecules. While in subcutaneously inoculated
rabbits there was a gradual increase in antibody titer, with a satisfactory
immune response being achieved from the 2nd WPV, these results
agreed with those of other authors,(20) who found that Montanide oil IMS 1313 VG NP-based vaccine induced a
protective neutralizing serum antibody titer from the 2nd WPV,
reached the highest level at the 3rd month post vaccination (MPV)
and persisted at protective level for 9th MPV. After 21 days post vaccination, ten rabbits from each group
were challenged intramuscularly at a dose of 1 mL/rabbit containing 100 LD50
of the homologous RHDV2; it was found that S/C
vaccinated rabbits provided satisfactory protection recording 90%, while orally
vaccinated rabbits had low protection 30%; these data agreed with another
study,(21) which found that IMS 1313 N adjuvanted vaccines
conferred improved protection to vaccinated animals compared to the commercial
reference.
In the current study, the
levels of lysozyme and NO were increased along the experimental intervals in
the vaccinated groups compared to the control group. These results agree with
findings of other authors,(22) who
found an increase in the lysozyme level in rabbits at 14th and 30th
day after S/C RHV vaccination and increased phagocytic capacity of
polymorphonuclear cells, which may increase their function and, therefore, the
production of NO from these cells. Moreover, vaccination against C. perfringens type C, D and C. oedematiens type B and C3 genotypes in dairy sheep
influenced humoral factors of innate immunity and increased the lysozyme level.
IL-6 and TNF levels
increased parallel to the increases in the innate immune parameters (lysozyme
and NO) tested for the oral and S/C routes compared to the control; significant
highest values were recorded for the S/C route. These increased levels of
pro-inflammatory cytokines agreed with other study(23)
where S/C vaccination with the viral hemorrhagic septicemia vaccine
increased the level of cellular immune response and the level of cytokines
(IL-6 and TNF-α) in the rabbit thymus.
Conclusions
The prepared vaccine was
safe, sterile and free from any contaminant. Vaccination by S/C route induced
high HI antibody and antitoxin titers against RHDV2 and C. perfringens
type A, respectively, in addition to a high percentage of protection against
RHDV2 challenge compared to the oral route. Lysozyme, NO, IL-6 and TNF-α
in rabbits vaccinated subcutaneously were optimum compared to the oral route.
References
1. Hemida
RE, Khaliel SA, Al-Ebshahy
EM, Abotaleb MM. Comparative
Study between the Isolated Rabbit Hemorrhagic Septicemia Virus and Available
Vaccine Strain. Inter J Vet Sci. 2020; 9(2): 189-95. doi:
https://10.37422/IJVS/20.004.
2. Capucci L, Cavadini P, Schiavitto
M, Lombardi G, Lavazza A. Increased pathogenicity in rabbit hemorrhagic disease
virus type 2 (RHDV2). Vet Rec. 2017; 180(17): 426. doi:
https://10.1136/vr.104132.
3. World Organisation for Animal Health (OIE). Rabbit hemorrhagic
disease. In: OIE. Manual of diagnostic tests and vaccines for terrestrial
animals. París: OIE; 2018.p.1389- 406.
4. Saadh MJ, Lafi FF, Dahadha AA, Albannan MS.
Immunogenicity of newly developed vaccine against Clostridium perfringens
alpha-toxin in rabbits and cattle. Vet World. 2022;15(7): 1617-23. doi:
https://10.14202/vetworld.2022.
5.
Liu B, Cao B, Wang C, Han B, Sun T, Miao Y, et al. Immunogenicity
and Safety of Childhood Combination Vaccines: A Systematic Review and
Meta-Analysis. Vaccines. 2022; 10(3):472. doi:
https://10.3390/vaccines10030472.
6. Abido O, Abotaleb MM, Nahed Y, Ayman HE, Aziza MA, Ahmed AE. Protective
efficacy of an inactivated vaccine against rabbit hemorrhagic disease virus 2
prepared from a local isolate in Egypt. VacciMonitor.2020; 29(3):143-50.
Available at:
https://vaccimonitor.finlay.edu.cu/index.php/vaccimonitor/article/view/256.
Access online: (November 15, 2023).
7.
El-Maghraby A, Abd El-Moneim
SW, Abd El- Moneam MM, Khalaf M, Abo-Dalal SE, Omar LM. Preparation
and evaluation of locally prepared inactivated combined vaccine of rabbit haemorrhagic disease virus, Pasteurella multocida and Clostridium perfringens type A.
Bioscience Research. 2019; 16(4):3973-86. Available
at: https://www.researchgate.net/publication/354852524_Preparation_and_evaluation_of_locally_prepared_inactivated_combined_vaccine_of_rabbit_haemorrhagic_disease_virus_Pasteurella_multocida_and_Clostridium_perfringens_type_A.
Access online: (November 15, 2023).
8. Jang SI, Lillehoj HS, Lee SH, Lee KW, Lillehoj
EP, Bertrand F, et al. Montanide IMS 1313 N VG PR
nanoparticle adjuvant enhances antigen-specific immune responses to profilin
following mucosal vaccination against Eimeria acervulina.
Vet Parasitol. 2011; 182(2–4), 163–70. doi: https://10.1016/j.vetpar.2011.05.019.
9. Ragland SA,
Criss AK. From bacterial killing to immune modulation: Recent insights into the
functions of lysozyme. PLoS Pathog.2017; 13(9):e1006512. doi:
https://10.1371/journal.ppat.1006512.
10. Soufli I, Toumi R, Rafa H, Touil-Boukoffa C.
Overview of cytokines and nitric oxide involvement in immuno-pathogenesis of
inflammatory bowel diseases. World J Gastrointest Pharmacol Ther. 2016;7(3):353-60.
doi: https://10.4292/wjgpt.v7.i3.353.
11.
Swaggerty CL, Kaiser P, Rothwell L, Pevzner IY, Kogut MH. Heterophil cytokine
mRNA profiles from genetically distinct lines of chickens with differential
heterophil-mediated innate immune responses. Avian Pathol. 2006; 35(2):102–8.
doi:https://10.1080/03079450600597535.
12.
Peeters TL, Vantrappen GR. Factors influencing lysozyme determination by
lysoplate method. Clin Chim Acta. 1977;74(3):217-25.
doi:https://10.1016/0009-8981(77)90288-1.
13. Yang
X, Sun Q, Asim MB, Jiang X, Zhong B, Shahzad M, et al. Nitric oxide in both bronchoalveolar
lavage fluid and serum is associated with pathogenesis and severity of antigen
induced pulmonary inflammation in rats. J Asthma. 2010; 47 (2):135–44.
doi:https://10.3109/02770900903483808.
14. Yuan
JS, Reed A, Chen F, Stewart CN. Statistical analysis of real-time PCR data. BMC
Bioinformatics. 2006; 7:85. doi:https://10.1186/1471-2105-7-85.
15.
Schnupf P, Sansonetti PJ. Quantitative RT-PCR profiling of the Rabbit Immune
Response: Assessment of Acute Shigella flexneri Infection. PLoS ONE. 2012; 7(6):
e36446. doi:https://10.1371/journal.pone.0036446.
16.
Godornes C, Leader BT, Molini BJ, Centurion-Lara A, Lukehart SA.
Quantitfication of rabbit cytokine mRNA by Real-Time RTPCR. Cytokine.
2007; 38(1): 1–7. doi:https://10.1016/j.cyto.2007.04.002.
17. El-Akkad TA, Zaki KE, El-Nagar AG, Refaat MH. Molecular
evaluation of prepared Rift Valley Fever (RVF) vaccine using Montanide Gel 02
and its effect on the genetic material. Benha J Appl Sci. 2022; 7(4): 13-9.
doi:https://10.21608/bjas.2022.251242.
18. Riffault S, Meyer G, Deplanche M,
Dubuquoy C, Durand G, Soulestin
M, et al. A new subunit vaccine based on nucleoprotein nanoparticles confers
partial clinical and virological protection in calves
against bovine respiratory syncytial virus. Vaccine. 2010; 28(21):3722–34. doi:
https://10.1016/j.vaccine.2010.03.008.
19.
United States Department of Agriculture (USDA). Center for Veterinary Biologics
Notice No. 02-25, conditional licenses for products containing Clostridium
perfringens type A. Washington DC: USDA;2002.
20.
El-Bagoury GF, El-Habbaa
AS, Ibrahim AM, Noha EY. Evaluating humoral immune
response of sheep vaccinated with inactivated RVF virus vaccine using oil
nanoparticles adjuvant in comparison with aluminum hydroxide gel. Benha Vet Med J. 2017; 33 (2):174-82. doi: https://10.21608/bvmj.2017.30025.
21. Deville S, Arous JB, Bertrand F, Borisov V, Dupuis L. Efficacy of
intranasal and spray delivery of adjuvanted live vaccine against infectious
bronchitis virus in experimentally infected poultry. Procedia Vaccinol.
2012; (6): 85 – 92. doi: https://10.1016/j.provac.2012.04.012.
22. Stancu CA, Cărpinișan L, Ghișe A,
Marcu A, Pentea MC, Dumitrescu E, et al.
Clinical chemistry, haematology, immune response and histological
evaluation of rabbits after immunization and challenge with rabbit haemorrhagic
disease (RHD) virus. World Rabbit Sci. 2017; 25: 357-65.
doi:https://10.4995/wrs.2017.7500.
23. Reda IE, AboSalem ME, El Zoghby EM, Attia
HF, Emam MA. Immunohistochemical studies on thymus
gland of rabbits after vaccination with viral hemorrhagic septicemia vaccine. Benha Vet Med J. 2019; 36(1):203-8. doi:
https://10.21608/bvmj.2019.119831.
Conflict of interest
The authors declare that
there is no conflict of interest.
Author’s
contributions
Mahmoud M. Abotaleb: Conducted the experiment, drafted the manuscript.
Designed the study and followed up the experiment and critically reviewed the
manuscript. Participated in study design and followed up on the practical work.
Rasha G. Tawfik: Designed the study and followed up the experiment and
critically reviewed the manuscript. Participated in study design and followed
up on the practical work.
Dalia M. Omar: Designed the study and
followed up the experiment and critically reviewed the manuscript. Participated
in study design and followed up on the practical work.
Farida H. Mohamed: Designed
the study and followed up the experiment and critically reviewed the
manuscript. Participated in study design and followed up on the practical work.
Shereen M. Aly: Designed
the study and followed up the experiment and critically reviewed the
manuscript. Participated in study design and followed up on the practical work.
Noura M. Khalaf: Designed the
study and followed up the experiment and critically reviewed the manuscript.
Participated in study design and followed up on the practical work.
Samir A. Nassif: Conducted
the experiment, drafted the manuscript. Designed the study and followed up the
experiment and critically reviewed the manuscript. Participated in study design
and followed up on the practical work.
All authors have read and
agreed to the published version of the manuscript.
*Associate Professor, Central Laboratory for Evaluation
of Veterinary Biologics (CLEVB), Agricultural Research Center (ARC), Cairo,
Egypt.