Original Article
Alternative method using Real Time PCR for evaluation of inactivated
Newcastle disease viral vaccine
Método alternativo de PCR en tiempo
real para la evaluación de la vacuna vírica inactivada contra la enfermedad de
Newcastle
Mounir
El Safty ORCID: https://orcid.org/0000-0003-1199-1375
Hala
Mahmoud* ORCID: https://orcid.org/0000-0003-2462-956X
Reem A. Soliman
ORCID: https://orcid.org/0000-0003-4074-4584
Central Laboratory for Evaluation of Veterinary
Biologics, Agriculture Research Center, Egypt.
Corresponding
author: haloldodo123@yahoo.com
ABSTRACT
The present work aims to
establish a new alternative protocol to evaluate in vitro potency of
inactivated Newcastle disease virus vaccine using Real Time PCR. Aqueous phases
of seven inactivated Newcastle disease virus vaccines batches of different
manufacturers were extracted by isopropyl myristate. The Newcastle disease
virus antigen of each vaccine sample was determined by a standard Real Time PCR
assay. Vaccines were inoculated into separate groups of 3-week-old specific
pathogen free chickens using the recommended dose of vaccine. The
immunogenicity was assessed for each vaccine by the Newcastle disease virus
hemagglutination inhibition antibody titers. Individual serum samples were
collected 4 weeks post vaccination, then vaccine efficacy and protection rates
were recorded after challenge test of birds vaccinated with the virulent
Newcastle disease virus. There is the possibility of using the Real Time PCR as
an in vitro assay for vaccine evaluation. The Cycle Threshold values
were ranged between 21.17 and 25.23. On the
other hand, the hemagglutination inhibition titers ranged between 7.1
log2 to 6.2. The comparison between the Cycle Threshold values of the antigen
extracts and the corresponding results of challenge test and in vivo hemagglutination inhibition assays
using sera of vaccinated birds proved a strong
correspondence between the in vitro and in vivo results.
Keywords: in vitro; inactivated vaccines;
Newcastle disease virus; Real Time PCR; vaccine potency.
RESUMEN
El
presente trabajo pretende establecer un nuevo protocolo alternativo para la
evaluación in vitro de la potencia de
la vacuna de virus inactivado contra la enfermedad de Newcastle mediante PCR en
tiempo real. Las fases acuosas de siete lotes de vacunas inactivadas contra el
virus de la enfermedad de Newcastle de distintos fabricantes se extrajeron mediante
miristato de isopropilo. El antígeno del virus de la enfermedad de Newcastle de
cada muestra de vacuna se determinó mediante un ensayo estándar de PCR en
tiempo real. Las vacunas se inocularon en grupos separados de pollos libres de
patógenos específicos de 3 semanas de edad utilizando la dosis recomendada de
vacuna. La inmunogenicidad se evaluó para cada vacuna mediante los títulos de
anticuerpos de inhibición de la hemaglutinación del virus de la enfermedad de
Newcastle. Se recogieron muestras individuales de suero 4 semanas después de la
vacunación y, a continuación, se registraron la eficacia de la vacuna y los
índices de protección tras la prueba de reto de las aves vacunadas con el virus
virulento de la enfermedad de Newcastle. Existe la posibilidad de utilizar la
PCR en tiempo real como ensayo in vitro
para la evaluación de vacunas. Los valores del umbral de ciclo oscilaron entre
21,17 y 25,23. Por otra parte, los títulos de anticuerpos inhibidores de la
hemaglutinación oscilaron entre 7,1 log2 y 6,2. La comparación entre los
valores del umbral de ciclo de los extractos de antígeno con los resultados
correspondientes de la prueba de reto y los ensayos de inhibición de la
hemaglutinación in vivo, utilizando
sueros de aves vacunadas, demostró una fuerte correspondencia entre los
resultados in vitro e in vivo.
Palabras clave: in vitro;
vacunas de productos inactivados; virus de la enfermedad de Newcastle; Reacción
en Cadena en Tiempo Real de la Polimerasa; potencia de la vacuna.
Recibido: 1 de diciembre de 2022
Aceptado: 13 de marzo de 2023
Introduction
Newcastle
disease (ND) is an infectious highly contagious disease of poultry. It is
caused by the virulent strain of Newcastle disease virus (NDV). In the past, it
was known as avian paramyxovirus serotype 1 and characterized mainly by
damaging to the central nervous system and digestive tract(1) with
high mortality rates. According to the international reports, there were about
four fatal outbreaks of ND around the world that caused huge harm to poultry
industry and international trade.(2) NDV is an ancient endemic avian
disease in Egypt. The current policy for its control depends on vaccination.(2)
An in vitro potency
method can be used to evaluate the NDV inactivated oil-adjuvant vaccines. The
vaccine batch can be judged as approved or rejected according to quantification
of the hemagglutinin-neuraminidase (HN) antigen amount per dose in the aqueous
phase of the vaccine post extraction by isopropyl myristate (IPM).(3)
Hundreds of
different oil-adjuvant monovalent and combined NDV vaccines are registered
annually at Central Laboratory for Evaluation of Veterinary Biologics (CLEVB)
to be evaluated for their quality. Routine in-vivo
evaluation procedures are applied according to Egyptian Standards Regulations for Evaluation of Veterinary Biologics.(4)
The current standard in vivo method
to evaluate NDV vaccines includes vaccination of chickens with the recommended
vaccine dose and route, collection of blood samples at 28th day post
vaccination for serological hemagglutination inhibition (HI) testing and
challenge test with ND virulent virus.
In vivo methodology for potency
testing is time-consuming and not cost-effective. Hence, the establishment and
development of new in vitro potency assays for inactivated NDV vaccines
is essential to improve the monitoring and approval process of vaccine before
release to markets. This target is of high priority to the CLEVB to reduce the
time required for vaccines evaluation. The present study illustrates the
application of Real Time PCR (RT-PCR) to evaluate NDV vaccine efficacy, by
determination of NDV antigen in inactivated vaccines.(5) The RT-PCR
assay is an ideal, simple and fast method with reduced risks of contaminations.
Additionally, RT-PCR is more specific and sensitive method.(6)
Material and
Methods
Vaccines
Seven different
inactivated NDV vaccines batches were selected randomly to vaccinate seven
groups of 3-week-old chicks according to Egyptian Standards Regulations.(4,7) The same
batches were used for ND antigen recovery technique for further antigen
determination quantification. The used vaccines differed in the contained virus
strains, inactivation method and composition.
Chickens
Two hundred,
3-week-old specific pathogen free (SPF) chickens were obtained from the SPF Egg
Production Farm, Koum Osheim, El-Fayoum, Egypt.
Virus
To assure
vaccines potency, chickens were challenged by virulent NDV type 7
NDV-B7-RLQP-CH-EG-12, accessionNoKM288609. This virus strain was also used to
hemagglutination (HA) and HI tests. It was kindly obtained from Strain Bank of
CLEVB, Abbasia, Cairo, Egypt.
Potency test
A vaccination
challenge test was conducted using 3-week-old SPF chicks that were divided into
eight groups (25 each group) and kept in separate isolators. Chickens in groups
1 to 7 were vaccinated with ND vaccines; group 8 was the non-vaccinated control
group. Chickens were vaccinated as recommended on the vaccine label and kept
isolated under observation for at least 28 days. On day 28th post
vaccination, blood samples were collected for haemagglutination inhibition (HI)
and then, the vaccinates and at least 10 unvaccinated chickens that had been
kept isolated as controls were challenged with Embryo infectious dose 50 (EID 50)/0.1
mL (per bird) of the virulent strain of NDV Genotype 7 (virulent
NDV type 7 NDV-B7-RLQP-CH-EG-12) supplied by the CLEVB strain bank and the
vaccinates observed each day for 14 days. If at least 90 percent of the
controls do not show typical signs of ND or die within 6 days of ND, the test
may be repeated. If at least 90 percent of the vaccinated do not remain normal,
the vaccine is unsatisfactory as described in Office International des
Epizootics (OIE).(7) The protection percentage of the seven
vaccines were measured after vaccination; the percentage of protection should
be greater than or equal to 90%.
Hemagglutination
inhibition test
On day 28th post vaccination, blood samples were collected for
serological tests to determine the ND antibody titer for each vaccine by HI
test as described in OIE(7) The serum samples collected
at 28th day for were tested by HI test to determine the elicited
antibody titer against NDV. Two fold serial dilution of serum samples from 1/2
to 1/2048 were applied against 4 hemagglutination (HA) units of ND antigen 106
EID 50/0.1 mL using HA test.(7) HI antibody titer geometric mean was
calculated.(8,9) The mean HI titer should be at least 6 1og2.
ND Antigen
recovery and extraction
Six mL of each
oil-emulsion vaccine were mixed and shaked well with 24 mL of IPM for 2 min at
2500/min, then centrifuged for 10 min at 2500 rpm at 4oC. The
resultant aqueous phase was collected separately for each vaccine for ND
antigen determination quantification by RT-PCR.(10)
RNA extraction
RNA extraction was done for
seven extracted ND antigen using QIA amp viral RNA Mini kit (Qiagen, Germany,
GmbH). One hundred and forty µL of the ND antigen extract were incubated with
5.6 µL of carrier RNA and 560 µL of AVL lysis buffer at room temperature for 10
min. 560 µL of absolute ethanol was added to the resultant lysate to be washed
and centrifuged as recommended by the manufacturer’s instruction. Nucleic acid
was then eluted by 60 µL of AE elution buffer.
RT-PCR
amplification
The reaction was done in
MX3005P RT-PCR machine in a final volume of 25µL containing 3µL of RNA
template, 12.5 µL of 2x QuantiTect Probe RT-PCR
Master Mix, 8.625 µL PCR grade water, 0.25 µL of each primer (50 pmol
conc.) and 0.125 µL of each probe (30 pmol conc.) and 0.25 µL of QuantiTect RT
Mix (Table 1). The Reverse transcription was applied at 50oC for 30
min. Afterwards primary denaturation was adjusted at 94oC for 15
min. 40 cycles of denaturation at 94oC for 15 sec were done to be
followed by annealing at 55oC for 30 sec and finally, extension at
72oC for 10 sec.
All reactions that recorded
Ct values were considered positive and reactions that did not record Ct values
were considered negative.(11)
Table 1. Oligonucleotides, primers and probes (Metabion, Germany).(12)
|
Gene |
Primer/probe sequence 5'-3' |
|
|
M+4100 AGTGATGTGCTCGGACCTTC-3’ |
|
ND (M) |
M-4220
CCTGAGGAGAGGCATTTGCTA-3’ |
|
|
M+4169
(FAM)TTCTCTAGCAGTGGGACAGCCTGC(TAMRA)-3’ |
M: matrix protein (M) gene of NDV
Ethical
approval
All
methods in the study were performed according to relevant guidelines and
regulations. All experiments were carried according to ARRIVE 2.0 guidelines
and were approved by the Institutional Animal Care and Use Committee (IACUC) in
the Faculty of Veterinary Medicine, Cairo University under the code (VetCU01102020217).
Results
Hemagglutination
inhibition test and efficacy results (in vivo potency)
Seven different batches of inactivated NDV vaccines were evaluated at
CLEVB for their potency by traditional methods (vaccination, serological and
challenge test) to reveal satisfactory results (Table 2). These data were
considered for further assessment of an alternative method.
To assure the
potency of each vaccine, chickens were challenged with the virulent NDV
Egyptian isolate of genotype VII. All tested batches could protect vaccinated
SPF chickens, the percentage of protection ranged from 90% to 100% (Table 2).
The protection percentage shows correspondence with HI antibody titers of sera
from vaccinated chickens; the vaccine batch (A) recorded the highest titer 7.1
log2 with 100% protection, batches (B and C) 6.5 log2
with 95 % protection, batches (D, E and F) 6.3 log2 with protection
90% and batch (G) recorded 6.2 log2 with 90% protection. These
results are considered as the starting point of the study to find a coincidence
between immune
response of each vaccine and the antigen determination (by RT-PCR) as an
alternative method to the traditional potency assay.
Table 2. Humoral immune response and protection rates
of SPF chickens vaccinated with inactivated NDV vaccines.
|
Test |
Vaccine lab symbol |
|||||||
|
A |
B |
C |
D |
E |
F |
G |
Control |
|
|
HI titer (log2) |
7.1 |
6.5 |
6.5 |
6.3 |
6.3 |
6.3 |
6.2 |
- |
|
Protection % |
100 |
95 |
95 |
90 |
90 |
90 |
90 |
10 |
Protective HI antibody titer ≥ 6 (log2). Protection level (%)
of challenge test ≥ 90%.
Real Time PCR
NDV antigens of the tested vaccines were efficiently extracted by oil
adjuvant breakdown using IPM to be identified and determined by RT-PCR.
Different antigen titers were found (Table 3), but in general, the higher
antigen amounts the higher serological response.
When RT-PCR was
used to determine NDV antigens it was recorded for vaccine batches G, F, E, D,
C, B 25.23 Ct, 24.81 Ct, 24.09 Ct, 23.24 Ct, 22.84 Ct, 22.75 Ct, respectively
and for batch A, 21.17 Ct (Table 3). It is noticed that there was coincidence between
the HI titers and Ct values.
Table
3. Mean Ct values of the in vitro Real Time PCR for extracted ND antigen.
|
Sample No. |
HI Titer |
Result |
Ct value |
|
A |
7.1 |
+ |
21.17 |
|
B |
6.5 |
+ |
22.75 |
|
C |
6.5 |
+ |
22.84 |
|
D |
6.3 |
+ |
23.24 |
|
E |
6.3 |
+ |
24.09 |
|
F |
6.3 |
+ |
24.81 |
|
G |
6.2 |
+ |
25.23 |
|
Control Group |
- |
- |
No Ct |
Ct values > 40 reveals
negative results.
Coincidence
between in vivo and in vitro alternative methods
The
coincidence between
the in vivo and in vitro evaluation methods obtained for
different vaccines batches was outlined in Figure 1.
Fig. 1. Relation between in vivo HI and challenge test and in vitro
alternative RT-PCR methods.
Discussion
The establishment
of alternative in vitro potency methods for batch release of inactivated
NDV vaccines is a high priority for the Egyptian CLEVB to reduce the cost and
save time in relation to in vivo potency testing. Strict batch-to-batch
potency assays of all NDV vaccines are applied by CLEVB. Evaluation of inactivated
avian viral vaccines, traditionally based on vaccination of 3-week-old SPF
chickens with a full dose, is routinely performed to assess the potency of
commercial vaccines. When in vivo
potency tests were applied, HI antibody titers ≥ 6 log2 were obtained
in serum samples collected 4 weeks post vaccination and at least 90%
protection, indicating a satisfactory protection rate. The vaccinated chickens
were subjected to challenge test with further observation for 6-day, after
these 6 days the trial was considered valid.
According to
previous data, the evaluation procedure needs at least 34 days, which is a long
period, therefore it is necessary to minimize the evaluation time.(5,7)
The known
cross-reaction between some avian paramyxoviruses and NDV leads to uncertainty
in ND serological assays, like the HI test. Conventional serological tests have
an insurmountable barrier for typing. From this point, there is a need to
establish a standard molecular assay to accurately detect and quantify NDV
antigen. RT-PCR assays play an important role in rapid identification of NDV
and also provide its accurate distinguishing from other closely related avian
paramyxovirus pathogens. In this study, RT-PCR was introduced as an alternative
accurate time-saving protocol.(12,13)
The study
discusses the use of RT-PCR as an in vitro alternative method for
evaluation of inactivated NDV vaccines for poultry. RT-PCR was applied for NDV
antigen determination parallel with traditional immunogenic and potency tests
to find a coincidence between the in vivo and in vitro
techniques. The inactivated NDV antigens could be isolated from water-in-oil
emulsion inactivated vaccines by IPM and quantified by RT-PCR. Antigen
isolation facilitated the comparison between the amounts of NDV antigen and the
titer of ND antibody response post vaccination with seven different inactivated
ND vaccines from different manufacturers.
From the
mentioned results, amount of NDV antigen looked to be a considerable indicator of
serological immune response, as it was clear that the high antigen content
resulted in a high antibody titer. These results are in agreement with a
previous study(14) that
demonstrated the potential of the RT PCR assay as an alternative
rapid method to traditional virus titration for evaluation of inactivated viral
vaccines. This comparison may be an additional evidence of the in vivo potency and efficacy of the
inactivated NDV vaccine. The study considered the results of seven batches of
inactivated NDV vaccines which were previously evaluated at CLEVB for their
efficacy and potency by using traditional methods including HI and challenge
test. The seven vaccine batches revealed satisfactory results for the protection
percentage (equal to or higher than 90%) and protective HI antibody titer (greater
than 6 log2).(15)
Additionally,
serological and vaccination challenge tests are known to have shortcomings
because the immune response and protection are measured at specific time point
post vaccination under specific standard conditions. On the other hand, the in
vitro antigen determination assay is a suitable method for this purpose,
being simple, relatively cheap and robust and help avoiding the animals use.(3)
Globally, there
is few antigen determination assays that are accepted as alternatives to
potency tests for inactivated vaccines. In Europe, antigen determination is not
accepted as an alternative to the in vivo potency assay of veterinary
vaccines,(16) but in USA, these assays are used instead of
traditional assays for inactivated viral veterinary vaccines.(17)
The study
recommends the application of Real Time PCR as a reliable technique for
evaluation of inactivated ND vaccine efficacy. Furthermore, the relationship
between the in vitro amount of antigen and protection percentage has to
be calculated for each newly registered vaccine, as it is important to make
general criteria for the antigen determination assays by RT-PCR and HI antibody
titer for each vaccine.(3)
Several
previous studies have been conducted to apply in vitro potency assays to
replace the time consuming in vivo assays, by determination of the NDV
antigen content by RT-PCR of tested vaccines after antigen extraction by IPM.(18,19)
The present
study was established to perform an easy, accurate and fast substitutive
protocol to the conventional one. Seven inactivated NDV oil-adjuvanted vaccine
samples of batches manufactured by different companies were treated with IPM,
resulted in successful extraction of the NDV antigen which was determined using
RT-PCR assay.
RT-PCR
successfully detected NDV antigen in all extracted vaccine samples which showed
a correspondence between the antigen amount measured by RT-PCR assay and the HI
titer of collected serum samples at 28 days post vaccination. Hence, the in
vivo challenge potency test was applied to confirm the effectiveness
of the seven selected batches which recorded Ct values between 21.17 and 25.23 to be used for immunogenicity assays. The obtained results are in agreement with those
obtained by a previous study.(10)
Previous
studies reported a correlation between the in vivo and in vitro
potencies for different vaccines regardless the inactivation method. The
vaccination challenge study did not reveal clear differences between the in
vivo tests for the evaluated vaccines. But the vaccination serology assay
revealed that the in vivo potency of the tested vaccines was different
as the antibody titer ranged from 7.1 log2 to 6.2 log2. Additionally, the potency
of the vaccines cannot exceed its limit, including a higher than adequate concentration
of antigen administered.(3)
The RT-PCR
technique is characterized by its ability to monitor exactly when the DNA
amplification occurs. Using a standard curve allows the analysis of the unknown
templates. When comparing conventional methods to RT-PCR, several advantages
are found as a high sensitivity, rapidity, low false positives and the accurate
analysis. Moreover, RT-PCR is a powerful technique for safe determination of
gene expression in addition to its specificity, sensitivity and reproducibility
without need to animal immunization.(12,13)
On the vaccine evaluation
scale, the HI test cannot differentiate vaccinated from infected chickens which
to some extent may interfere with the judgment reports by releasing the vaccine
batch as satisfactory, but in fact the chicken might be infected.
Conclusions
RT-PCR can be considered a good, fast, safe, accurate, low cost and time
saving tool and has the ability to replace the traditional efficacy and potency
methodology according to the results obtained. Antigen determination by RT-PCR
could replace the in vivo potency method for evaluation of NDV
inactivated vaccines.
Acknowledgment
The authors are grateful
and thankful to the CLEVB and Cairo University for their appreciated
cooperation and support.
References
1. Butt SL,
Moura V, Susta L, Miller PJ, Hutcheson JM, Cardenas-Garcia S, et al. Tropism of Newcastle
disease virus strains for chicken neurons, astrocytes, oligodendrocytes and
microglia. BMC Vet Res. 2019; 15(1):
317. doi: https://10.1186/s12917-019-2053-z.
2. Abozaid KGA,
Abdel-Moneim AS. Epidemiological surveillance of Newcastle disease virus in
Egypt - a 6-year cohort study. Trop Anim Health Prod. 2022;54(4):243. doi: https://10.1007/s11250-022-03234-3.
PMID: 35909216.
3. Ike AC,
Ononugbo CM, Obi OJ, Onu CJ, Olovo CV, Muo SO, et al. Towards Improved Use of
Vaccination in the Control of Infectious Bronchitis and Newcastle Disease in
Poultry: Understanding the Immunological Mechanisms. Vaccines (Basel).
2021;9(1):20. doi: https://10.3390/vaccines9010020.
4. Egyptian Standards Regulations for
Evaluation of Veterinary Biologics 3rd edition. (2017).
5. Cheung CY, Dubey S, Hadrovic M, Ball CR, Ramage W, McDonald JU, et al.
Development of
an ELISA-Based Potency Assay for Inactivated Influenza Vaccines Using
Cross-Reactive Nanobodies. Vaccines (Basel). 2022; 10 (9): 147. doi:
https://10.3390/vaccines10091473.
6. Valasek MA,
Repa JJ. The power of real-time PCR. Adv Physiol Educ. 2005; 29: 151–9. doi:
https://10.1152/advan.00019.2005.
7.Organization
for Animal Health (OIE). New castle Disease (Infection with New Castle Disease
Virus). En: OIE. World Organization for Animal Health. Manual of diagnostic
tests and vaccines for terrestrial animals (mammals, birds, bees). Paris: OIE;
2021. p. 1-22. Available from:
https://www.woah.org/fileadmin/Home/eng/Health_standards/tahm/3.03.14_NEWCASTLE_DIS.pdf.
(Acces on: May 19, 2022).
8. Newcastle
Disease Vaccine Killed Virus. 9
CRF 113.205. (2022).
9. Kärber G. Beitrag zur kollektiven Behandlung pharmakologischer
Reihenversuche. Archiv f experiment Pathol u Pharmakol.162:480–3.
1931.
10. Aly SE, Hussein HA, Aly AM, Abdel-Baky MH, El-Sanousi AA. Assessment of in vitro
potency of inactivated Newcastle disease oil-adjuvanted vaccines using
hemagglutination test and blocking ELISA. Vet
World. 2018; 11 (9): 1222-8. doi:https://10.14202/vetworld.2018.1222-1228.
11. Haegeman A, De
Vleeschauwer A, De Leeuw I, Vidanović D, Šekler M, Petrović T, et al. Overview
of diagnostic tools for Capripox virus infections. Prev Vet Med. 2022;
181:104704. doi:
https://10.1016/j.prevetmed.2019.104704.
12. El-Tholoth M, Branavan M, Naveenathayalan A, Balachandran W. Recombinase polymerase amplification-nucleic
acid lateral flow immunoassays for Newcastle disease virus and infectious
bronchitis virus detection. Mol Biol Rep. 2019;46(6):6391-7. doi:
https://10.1007/s11033-019-05085-y.
13.Zeynalova S, Guliyev F, Vatani M, Abbasov B. Biosurveillance of avian
influenza and Newcastle disease viruses in the Barda region of Azerbaijan using
real time RT-PCR and hemagglutination inhibition. Front Microbiol. 2015;6:1128.
doi: https://10.3389/fmicb.2015.01128.
14. Abousenna MS, Amal AM, Darwish MD, Khafagy HA, Shasha FA, Barghooth
WM, et al. Using of real
time PCR as a tool for quantification of sheep pox virus. J Anim Health Prod.
2020; 8 (2): 45-9. doi: https://10.14737/journal.jahp/2020/8.2.45.49.
15. Bodle J, Verity EE, Ong C, Vandenberg K, Shaw R, Barr IG, et al. Development of an
enzyme-linked immunoassay for the quantitation of influenza haemagglutinin: An
alternative method to single radial immunodiffusion. Influenza Other Respir
Viruses;2013; 7: 191-200. doi: https://j.1750-2659.2012.00375.x.
16. European Directorate for the Quality of Medicines & HealthCare
(EDQM). European Pharmacopoeia 10th ed. Strasbourg: EDQM; 2021.
17. Code of Federal Regulations
(CFR). Title 9 Parts 1–199. Washington DC: US Government Printing Office;2000.
Available at:. http://www.gpo.gov/fdsys/pkg/CFR-2006-title9-vol1/pdf/CFR-2006-title9-
vol1-chapI.pdf.
18. Abdel Rahman SS, Abel Wanis NA, Aly MA, Abdel-Rahman A, Sae A. Detection of antigen
content of inactivated oil Newcastle disease vaccines by a new laboratory
method. Kafer El-Sheikh Vet Med J. 2006; 4: 267-76.
19.
Motitschke A, Jungbäck C. The quantitative ELISA for inactivated Newcastle antigen: Experience
report from an OMCL. Dev Biol. 2011; 134: 55-66.
Conflict of interest
The authors declare that
there is no conflict of interest.
Author’s
contributions
Mounir El
Safty: designed the experiments.
Hala Mahmoud:
performed the experiments and wrote the manuscript.
Reem A Soliman:
performed the experiments and wrote the manuscript.
All authors reviewed and
approved the final version of this manuscript for publication.
*PhD, senior researcher at
Agriculture Research Center, Central Laboratory for Evaluation of Veterinary
Biologics, Cairo, Egypt.